Prost Plato Digital Cryptocurrency Game Dog - Mix of St. Bernard, Corgi, Grey Wolf, Beagle, Pitbull terrier, Border Collie and Yorkshire Terrier

Achievements

None
Prost Plato
I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I'll lick anything. My favorite way to relax is to be scratched on my belly. I'm not into dog collars, unless you're into S & M. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 9%
  • Age 16 days
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCCCCCTATCCTGACCCTACAGCTTATGATGA
A
G
C
C
C
C
C
T
A
T
C
C
T
G
A
C
C
C
T
A
C
A
G
C
T
T
A
T
G
A
T
G
A
Genes: OLDNBLJOFBB

Composition

St. Bernard
27%
Corgi
18%
Grey Wolf
18%
Beagle
9%
Pitbull terrier
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality +9 points
Lunar Effect +4 points

Traits Breakdown

Body Corgi
Tail Grey Wolf
Legs Beagle
Front Legs Pitbull terrier
Head St. Bernard
Ears Grey Wolf
Snout Border Collie
Mouth Corgi
Nose Yorkshire Terrier
Eyes St. Bernard
Color St. Bernard