Trooper The Chair Litecoin Game Dog - Mix of Shiba Inu and Boxer

Achievements

None
Trooper The Chair
Hullo. My name is Trooper The Chair. Ima Ethernet dog. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I'm sick of having my nails clipped, those are to help me dig! I enjoy exploration and am game for anything doggy-style.
  • Purity 82%
  • Age 18 days
  • Racing Exp 0
  • Shiba Inu 91%
  • 0 races
  • Gen 12
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTAAACGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
A
A
C
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEEGEEEEE

Composition

Shiba Inu
91%
Boxer
9%

Current Energy

Vitality +22 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Boxer
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children