Katniss Kirby Litecoin Dog - Mix of Pug, Yorkshire Terrier, Shiba Inu, German Shepard, Border Collie, St. Bernard and Labrador BK

Achievements

None
Katniss Kirby
Pleased to meet you! My name's Katniss Kirby. I've had my nose rubbed in 'it' more than once. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I enjoy exploration and am game for anything doggy-style.
  • Purity 11%
  • Age 19 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 5
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAGAAGTAGTATTATCATACGAAGAATGAGCA
T
T
A
G
A
A
G
T
A
G
T
A
T
T
A
T
C
A
T
A
C
G
A
A
G
A
A
T
G
A
G
C
A
Genes: F2EEF7J22B6

Composition

Pug
27%
Yorkshire Terrier
18%
Shiba Inu
18%
German Shepard
9%
Border Collie
9%
St. Bernard
9%
Labrador BK
9%

Current Energy

Vitality +9 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pug
Legs Shiba Inu
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears German Shepard
Snout Border Collie
Mouth Pug
Nose Pug
Eyes St. Bernard
Color Labrador BK