Rebel Rain Litecoin Game Dog - Mix of Maltese, Shiba Inu, German Shepard, Beagle, Pug, Border Collie and St. Bernard

Achievements

None
Rebel Rain
I'm having some new data architecture built for me, then I'd like to have you over to my place. Aggressive dogs that don't let 'me be me' frustrate me. My human says I'm loyal, intelligent, devoted and affectionate. My female human wears crotchless undies, but she doesn't like the ones I make for her!
  • Purity 11%
  • Age 19 days
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 5
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCACTAACCGTAACCGTAGTAGAATACTGAACC
T
C
A
C
T
A
A
C
C
G
T
A
A
C
C
G
T
A
G
T
A
G
A
A
T
A
C
T
G
A
A
C
C
Genes: 7DKEKEE2JBK

Composition

Maltese
27%
Shiba Inu
27%
German Shepard
9%
Beagle
9%
Pug
9%
Border Collie
9%
St. Bernard
9%

Current Energy

Vitality +22 points
Lunar Effect +12 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Maltese
Front Legs Shiba Inu
Head Maltese
Ears Shiba Inu
Snout Shiba Inu
Mouth Pug
Nose Border Collie
Eyes St. Bernard
Color Maltese