Joplin Jill Bitcoin Game Dog - Mix of Maltese, German Shepard, Border Collie, Beagle, Grey Wolf, Rottweiler and Pitbull terrier

Achievements

None
Joplin Jill
What's up, pup? Name's Joplin Jill. I hate hiding under the bed during a thunder storm but that's just smart, right? I believe running along the beach to catch a stick can be nearly orgasmic. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 9%
  • Age 15 months
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACTAACCTCAACCCCCCACTCCTACTACACC
T
C
A
C
T
A
A
C
C
T
C
A
A
C
C
C
C
C
C
A
C
T
C
C
T
A
C
T
A
C
A
C
C
Genes: 7DK7KLHNJJK

Composition

Maltese
27%
German Shepard
18%
Border Collie
18%
Beagle
9%
Grey Wolf
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality -34 points
Lunar Effect +2 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Maltese
Front Legs German Shepard
Head Maltese
Ears Grey Wolf
Snout Rottweiler
Mouth Pitbull terrier
Nose Border Collie
Eyes Border Collie
Color Maltese