Nyx Nissan Litecoin Dog - Mix of Border Collie, Pitbull terrier, Corgi, Labrador and Labrador BK

Achievements

None
Nyx Nissan
I absolutely love long walks when I can stop and smell the bushes. I hate having to share my food dish... I'd like to help you shed your coat, baby. I think hamsters and cats are both over-rated. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 21%
  • Age 19 days
  • Racing Exp 0
  • Border Collie 45%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTACTCCTACTACCCATACGCAAGCTCCAGC
T
A
C
T
A
C
T
C
C
T
A
C
T
A
C
C
C
A
T
A
C
G
C
A
A
G
C
T
C
C
A
G
C
Genes: JJNJJ5J6ONO

Composition

Border Collie
45%
Pitbull terrier
18%
Corgi
18%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality +46 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Pitbull terrier
Front Legs Border Collie
Head Border Collie
Ears Labrador
Snout Border Collie
Mouth Labrador BK
Nose Corgi
Eyes Pitbull terrier
Color Corgi

Parents

No Children