Delia Data Digital Cryptocurrency Dog - Mix of Border Collie, Pitbull terrier, Corgi, St. Bernard, Pug and Schnauzer

Achievements

None
Delia Data
How you doin? ;) Delia Data here. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I love the smell of freshly cut grass. I'm going kill that damn Nyan Cat if I can catch it. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please.
  • Purity 12%
  • Age 22 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGATACTCCTCCTACGAATACAGCATATCCAGC
T
G
A
T
A
C
T
C
C
T
C
C
T
A
C
G
A
A
T
A
C
A
G
C
A
T
A
T
C
C
A
G
C
Genes: BJNNJ2JOCNO

Composition

Border Collie
27%
Pitbull terrier
27%
Corgi
18%
St. Bernard
9%
Pug
9%
Schnauzer
9%

Current Energy

Vitality +18 points
Lunar Effect +8 points

Traits Breakdown

Body St. Bernard
Tail Border Collie
Legs Pitbull terrier
Front Legs Pitbull terrier
Head Border Collie
Ears Pug
Snout Border Collie
Mouth Corgi
Nose Schnauzer
Eyes Pitbull terrier
Color Corgi