Rufus Red Flag Bitcoin Dog - Mix of Pitbull terrier, Labrador BK, Beagle, Rottweiler and Shiba Inu

Achievements

None
Rufus Red Flag
How YOU doin'? Rufus Red Flag here. Sometimes I just have to roll in something dead. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right?
  • Purity 15%
  • Age 15 months
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCCTACTATCCGCACACTCCGTAGCAGCACAC
T
C
C
C
T
A
C
T
A
T
C
C
G
C
A
C
A
C
T
C
C
G
T
A
G
C
A
G
C
A
C
A
C
Genes: NDDN6HNE66H

Composition

Pitbull terrier
27%
Labrador BK
27%
Beagle
18%
Rottweiler
18%
Shiba Inu
9%

Current Energy

Vitality -50 points
Lunar Effect +8 points

Traits Breakdown

Body Pitbull terrier
Tail Beagle
Legs Beagle
Front Legs Pitbull terrier
Head Labrador BK
Ears Rottweiler
Snout Pitbull terrier
Mouth Shiba Inu
Nose Labrador BK
Eyes Labrador BK
Color Rottweiler

Parents

No Children