Bubba Birdie Crypto Dog - Mix of Shiba Inu and Pug

Achievements

None
Bubba Birdie
My name is Bubba Birdie and I do tricks. As a digital dog, let me say Bob Dole did not invent the internet. I hate it when my humans fart and they blame me! I could spend days on end chasing my tail. I get so close but it's just so fast! If you are looking for companionship without commitment, so am I.
  • Purity 82%
  • Age 22 days
  • Racing Exp 0
  • Shiba Inu 91%
  • 0 races
  • Gen 10
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTAGAAGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
A
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEE2EEEEE

Composition

Shiba Inu
91%
Pug
9%

Current Energy

Vitality +22 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Pug
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu