May Master Chief Digital Cryptocurrency Game Dog - Mix of Border Collie, Labrador BK, Maltese, Labrador, Boxer, Pitbull terrier and French Bulldog

Achievements

None
May Master Chief
May Master Chief here. Wanna play? I hate having to share my food dish... If I can't reach it to clean it myself, it doesn't need cleaning! Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I'm hoping to find someone who'll howl at the moon with me.
  • Purity 9%
  • Age 23 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATACAACTCCGCACGAACCGCAACCTACTAC
C
C
A
T
A
C
A
A
C
T
C
C
G
C
A
C
G
A
A
C
C
G
C
A
A
C
C
T
A
C
T
A
C
Genes: 5JGN69K6KJJ

Composition

Border Collie
27%
Labrador BK
18%
Maltese
18%
Labrador
9%
Boxer
9%
Pitbull terrier
9%
French Bulldog
9%

Current Energy

Vitality +26 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador
Tail Border Collie
Legs Boxer
Front Legs Pitbull terrier
Head Labrador BK
Ears French Bulldog
Snout Maltese
Mouth Labrador BK
Nose Maltese
Eyes Border Collie
Color Border Collie