Blueberry Bosley Litecoin Dog - Mix of German Shepard, Border Collie, Husky, Shiba Inu, Grey Wolf, Rottweiler, Poodle, St. Bernard and Labrador BK

Achievements

None
Blueberry Bosley
Even living on the internet like I do, too much kibble makes my bandwidth expand. Steak is my absolute favorite, but I prefer to eat chicken for my health. I hate it when my humans fart and they blame me! I like to work out by digging fresh holes in landscaped yards.
  • Purity 3%
  • Age 5 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTATCATACCCCTCATACCACGACTGAGCA
A
C
A
G
T
A
T
C
A
T
A
C
C
C
C
T
C
A
T
A
C
C
A
C
G
A
C
T
G
A
G
C
A
Genes: 4E7JL7JHIB6

Composition

German Shepard
18%
Border Collie
18%
Husky
9%
Shiba Inu
9%
Grey Wolf
9%
Rottweiler
9%
Poodle
9%
St. Bernard
9%
Labrador BK
9%

Current Energy

Vitality -11 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs German Shepard
Front Legs Border Collie
Head Grey Wolf
Ears German Shepard
Snout Border Collie
Mouth Rottweiler
Nose Poodle
Eyes St. Bernard
Color Labrador BK