Quark Quby Crypto Dog - Mix of Boxer, Maltese, Pug, Golder Retriever, French Bulldog and Yorkshire Terrier

Achievements

Podium Champion
Pro Racer
Quark Quby
Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I hate it when my humans fart and they blame me! Creativity is my middle name... I turn everything in to a chew toy. I've been solitary dog...looking for someone worth changing over.
  • Purity 15%
  • Age 21 days
  • Racing Exp 49
  • Boxer 36%
  • 12 races
  • Gen 11
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

12 races   |
  • 3 1 2
 Best Time15.55 sec
Rank 65  Racing *** Pts
50.0 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGACGAACCAACGAAAACAACAACACCTTAGAA
A
G
A
C
G
A
A
C
C
A
A
C
G
A
A
A
A
C
A
A
C
A
A
C
A
C
C
T
T
A
G
A
A
Genes: 89KG2GGGKF2

Composition

Boxer
36%
Maltese
18%
Pug
18%
Golder Retriever
9%
French Bulldog
9%
Yorkshire Terrier
9%

Current Energy

Vitality +11 points
Lunar Effect -6 points

Traits Breakdown

Body Golder Retriever
Tail French Bulldog
Legs Maltese
Front Legs Boxer
Head Pug
Ears Boxer
Snout Boxer
Mouth Boxer
Nose Maltese
Eyes Yorkshire Terrier
Color Pug