Tiger Lilly Trixie Bitcoin Game Dog - Mix of French Bulldog, St. Bernard, Border Collie, German Shepard, Poodle, Pug, Rottweiler, Grey Wolf and Labrador

Achievements

None
Tiger Lilly Trixie
Tiger Lilly Trixie is the name, love is my game. And fetch of course... My 'G' spot is under my chin...scratch me there and I'll growl softly. My favorite game is Fetch except I never bring the ball back. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 6%
  • Age 21 days
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 9
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGATGATACCGATCAGACGAACACCCCCCACGA
C
G
A
T
G
A
T
A
C
C
G
A
T
C
A
G
A
C
G
A
A
C
A
C
C
C
C
C
C
A
C
G
A
Genes: 9BJ97I2HL59

Composition

French Bulldog
27%
St. Bernard
9%
Border Collie
9%
German Shepard
9%
Poodle
9%
Pug
9%
Rottweiler
9%
Grey Wolf
9%
Labrador
9%

Current Energy

Vitality +37 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail St. Bernard
Legs Border Collie
Front Legs French Bulldog
Head German Shepard
Ears Poodle
Snout Pug
Mouth Rottweiler
Nose Grey Wolf
Eyes Labrador
Color French Bulldog