Bond Big Foot Digital Cryptocurrency Dog - Mix of St. Bernard, Yorkshire Terrier, Pitbull terrier, Labrador, Maltese, Pug and Poodle

Achievements

Racer
Bond Big Foot
Hello, I be Bond Big Foot. Even living on the internet like I do, too much kibble makes my bandwidth expand. I'm the best at running circle 8's. My favorite place to sleep is under the covers between my humans. Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 9%
  • Age 23 days
  • Racing Exp 3
  • St. Bernard 27%
  • 3 races
  • Gen 1
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 0
 Best Time16.28 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTACCATCCACCTTATGAGAATGATGAGACTCC
T
T
A
C
C
A
T
C
C
A
C
C
T
T
A
T
G
A
G
A
A
T
G
A
T
G
A
G
A
C
T
C
C
Genes: F5NKFB2BBIN

Composition

St. Bernard
27%
Yorkshire Terrier
18%
Pitbull terrier
18%
Labrador
9%
Maltese
9%
Pug
9%
Poodle
9%

Current Energy

Vitality +5 points
Lunar Effect +8 points

Traits Breakdown

Body Yorkshire Terrier
Tail Labrador
Legs Pitbull terrier
Front Legs Maltese
Head Yorkshire Terrier
Ears St. Bernard
Snout Pug
Mouth St. Bernard
Nose St. Bernard
Eyes Poodle
Color Pitbull terrier

Parents

No Children

Photos