Mercy Marie Virtual Crypto Game Dog - Mix of Border Collie, Dachshund, Grey Wolf, Pug, Corgi, Yorkshire Terrier, Pitbull terrier and Golder Retriever

Achievements

Racer
Mercy Marie
Taking a break from chasing Nyan Cat around cyberspace. I don't mind sharing my bed with someone I just met, if we can cuddle. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I wish my human would stop putting clothes on me. Don't try to cover my flawless fur!
  • Purity 11%
  • Age 24 days
  • Racing Exp 23
  • Border Collie 36%
  • 6 races
  • Gen 0
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 0 2
 Best Time14.98 sec
Rank 18  Racing *** Pts
50.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGATACCCCTACTACGAATACAGCTTATCCAGA
G
G
A
T
A
C
C
C
C
T
A
C
T
A
C
G
A
A
T
A
C
A
G
C
T
T
A
T
C
C
A
G
A
Genes: AJLJJ2JOFN8

Composition

Border Collie
36%
Dachshund
9%
Grey Wolf
9%
Pug
9%
Corgi
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality +55 points
Lunar Effect -12 points

Traits Breakdown

Body Dachshund
Tail Border Collie
Legs Grey Wolf
Front Legs Border Collie
Head Border Collie
Ears Pug
Snout Border Collie
Mouth Corgi
Nose Yorkshire Terrier
Eyes Pitbull terrier
Color Golder Retriever

Parents

Children

Photos

crypto pet racing virtual pet race results Bitcoin dog race