Miss Kitty Mary Litecoin Dog - Mix of German Shepard, Beagle, Border Collie, Grey Wolf, Pug, Rottweiler, Pitbull terrier and Dachshund

Achievements

Racer
Podium Champion
Miss Kitty Mary
Who's a good dog? Hopefully you! Miss Kitty Mary here. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! If I can't reach it to clean it myself, it doesn't need cleaning! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 4%
  • Age 22 days
  • Racing Exp 36
  • German Shepard 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 3 1
 Best Time15.43 sec
Rank 47  Racing *** Pts
83.3 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCACTATACTCACCCGAACACTCCGGATACCTA
T
C
A
C
T
A
T
A
C
T
C
A
C
C
C
G
A
A
C
A
C
T
C
C
G
G
A
T
A
C
C
T
A
Genes: 7DJ7L2HNAJD

Composition

German Shepard
18%
Beagle
18%
Border Collie
18%
Grey Wolf
9%
Pug
9%
Rottweiler
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality +62 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Border Collie
Front Legs German Shepard
Head Grey Wolf
Ears Pug
Snout Rottweiler
Mouth Pitbull terrier
Nose Dachshund
Eyes Border Collie
Color Beagle

Parents

Children

Photos

crypto doggy racing online dog race Litecoin dog racing Bitcoin doggy race crypto dog racing results