Miss Kitty Mary Litecoin Dog - Mix of German Shepard, Beagle, Border Collie, Grey Wolf, Pug, Rottweiler, Pitbull terrier and Dachshund

Achievements

Podium Champion
Pro Racer
Master Champion
Miss Kitty Mary
Who's a good dog? Hopefully you! Miss Kitty Mary here. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! If I can't reach it to clean it myself, it doesn't need cleaning! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 4%
  • Age 15 months
  • Racing Exp 83
  • German Shepard 18%
  • 15 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 5 3 3
 Best Time14.58 sec
Rank 13  Racing *** Coins
73.3 % wins (11) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TCACTATACTCACCCGAACACTCCGGATACCTA
T
C
A
C
T
A
T
A
C
T
C
A
C
C
C
G
A
A
C
A
C
T
C
C
G
G
A
T
A
C
C
T
A
Genes: 7DJ7L2HNAJD

Composition

German Shepard
18%
Beagle
18%
Border Collie
18%
Grey Wolf
9%
Pug
9%
Rottweiler
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality +2 points
Lunar Effect +2 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Border Collie
Front Legs German Shepard
Head Grey Wolf
Ears Pug
Snout Rottweiler
Mouth Pitbull terrier
Nose Dachshund
Eyes Border Collie
Color Beagle