Lilly Legolas Digital Cryptocurrency Dog - Mix of German Shepard, Pug, Shiba Inu, Corgi, Husky, Dachshund, Schnauzer and Golder Retriever

Achievements

None
Lilly Legolas
Suh? How's it goin? I'm Lilly Legolas. I keep my well-built figure with zeros and ones. Sometimes I forget where I buried my bone. My favorite game is Fetch except I never bring the ball back. Creativity is my middle name... I turn everything in to a chew toy.
  • Purity 8%
  • Age 23 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAGAAGTAAGCACAGGATCATCAATAGAAAGA
T
C
A
G
A
A
G
T
A
A
G
C
A
C
A
G
G
A
T
C
A
T
C
A
A
T
A
G
A
A
A
G
A
Genes: 72EO4A77C28

Composition

German Shepard
27%
Pug
18%
Shiba Inu
9%
Corgi
9%
Husky
9%
Dachshund
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality +37 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Shiba Inu
Front Legs Corgi
Head Husky
Ears Dachshund
Snout German Shepard
Mouth German Shepard
Nose Schnauzer
Eyes Pug
Color Golder Retriever