Darla Deacon Litecoin Dog - Mix of Golder Retriever, Corgi, Beagle, St. Bernard, Yorkshire Terrier, Rottweiler, Pug and Shiba Inu

Achievements

None
Darla Deacon
I am really into starting howling wars with the neighborhood dogs. I'm the loudest! I don't understand why my human tries to give me tap water. I expect filtered and distilled! My 'G' spot is under my chin...scratch me there and I'll growl softly. I want someone who can show me a good time; I'll do the same for you.
  • Purity 8%
  • Age 15 months
  • Racing Exp 0
  • Golder Retriever 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCAGAAGACTATGATTAAGACACAGCGAAGTA
A
G
C
A
G
A
A
G
A
C
T
A
T
G
A
T
T
A
A
G
A
C
A
C
A
G
C
G
A
A
G
T
A
Genes: O88DBF8HO2E

Composition

Golder Retriever
27%
Corgi
18%
Beagle
9%
St. Bernard
9%
Yorkshire Terrier
9%
Rottweiler
9%
Pug
9%
Shiba Inu
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Golder Retriever
Legs Golder Retriever
Front Legs Beagle
Head St. Bernard
Ears Yorkshire Terrier
Snout Golder Retriever
Mouth Rottweiler
Nose Corgi
Eyes Pug
Color Shiba Inu