Betty Biddy Crypto Dog - Mix of Shiba Inu, Golder Retriever, Maltese, Pitbull terrier, St. Bernard and Pug

Achievements

None
Betty Biddy
The cloud's my neighborhood. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I don't mind sharing my bed with someone I just met, if we can cuddle.
  • Purity 14%
  • Age 26 days
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAAGAAGAACCTCCGTAAGATGAACCGAAGTA
G
T
A
A
G
A
A
G
A
A
C
C
T
C
C
G
T
A
A
G
A
T
G
A
A
C
C
G
A
A
G
T
A
Genes: E88KNE8BK2E

Composition

Shiba Inu
27%
Golder Retriever
27%
Maltese
18%
Pitbull terrier
9%
St. Bernard
9%
Pug
9%

Current Energy

Vitality +13 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Golder Retriever
Front Legs Maltese
Head Pitbull terrier
Ears Shiba Inu
Snout Golder Retriever
Mouth St. Bernard
Nose Maltese
Eyes Pug
Color Shiba Inu

Parents

No Children