Hans Hershey Bitcoin Dog - Mix of Rottweiler, Grey Wolf, Husky, Border Collie, French Bulldog and Shiba Inu

Achievements

None
Hans Hershey
I'm Hans Hershey and I'd like to show you a trick or two. I live inside of a Virtual machine two steps to the right from the firewall. I hate it when my humans fool me with a pill in peanut butter! Too much steak gives me the runs! Hope you like the smell of wet fur, because I'll jump into any water I see!
  • Purity 27%
  • Age 23 days
  • Racing Exp 0
  • Rottweiler 55%
  • 0 races
  • Gen 6
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCACACACACCACCACCACTACCACCGAGTA
C
C
C
C
A
C
A
C
A
C
A
C
C
A
C
C
A
C
C
A
C
T
A
C
C
A
C
C
G
A
G
T
A
Genes: LH4HHHHJH9E

Composition

Rottweiler
55%
Grey Wolf
9%
Husky
9%
Border Collie
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality +52 points
Lunar Effect +22 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Husky
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Rottweiler
Mouth Border Collie
Nose Rottweiler
Eyes French Bulldog
Color Shiba Inu