Farley Flamethrower Crypto Game Dog - Mix of Pitbull terrier, Border Collie, Corgi, Maltese, Beagle and French Bulldog

Achievements

None
Farley Flamethrower
Long or short hair works for me, just no baldies please. My favorite sport is catching treats my human throws! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! My 'G' spot is under my chin...scratch me there and I'll growl softly.
  • Purity 10%
  • Age 23 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCTCCAGCCTATACAGCTACTCCCGATCCTAC
A
C
C
T
C
C
A
G
C
C
T
A
T
A
C
A
G
C
T
A
C
T
C
C
C
G
A
T
C
C
T
A
C
Genes: KNODJOJN9NJ

Composition

Pitbull terrier
27%
Border Collie
27%
Corgi
18%
Maltese
9%
Beagle
9%
French Bulldog
9%

Current Energy

Vitality +10 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail Pitbull terrier
Legs Corgi
Front Legs Beagle
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Pitbull terrier
Nose French Bulldog
Eyes Pitbull terrier
Color Border Collie