Darth Vader Dreamer Cryptocurrency Dog - Mix of Husky, Rottweiler, Yorkshire Terrier, Grey Wolf, Pitbull terrier, French Bulldog and Poodle

Achievements

None
Darth Vader Dreamer
It's a barkin' beautiful day! Darth Vader Dreamer here. I'll be honest...Napping is my favorite so we gotta go slow. I'm willing to try little bondage, so my human chained me up! I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I just want a snuggle buddy with a nice, soft coat.
  • Purity 11%
  • Age 15 months
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 3
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACACAACACCCTCCTTATTACACCGAGACACA
C
A
C
A
C
A
A
C
A
C
C
C
T
C
C
T
T
A
T
T
A
C
A
C
C
G
A
G
A
C
A
C
A
Genes: H44LNFFH9I4

Composition

Husky
27%
Rottweiler
18%
Yorkshire Terrier
18%
Grey Wolf
9%
Pitbull terrier
9%
French Bulldog
9%
Poodle
9%

Current Energy

Vitality -20 points
Lunar Effect -14 points

Traits Breakdown

Body Rottweiler
Tail Husky
Legs Husky
Front Legs Grey Wolf
Head Pitbull terrier
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Rottweiler
Nose French Bulldog
Eyes Poodle
Color Husky

Parents

No Children