Nori Nikita Litecoin Game Dog - Mix of Corgi, Border Collie, Grey Wolf, Shiba Inu, Labrador, Pitbull terrier, French Bulldog, Husky and Dachshund

Achievements

Racer
Podium Champion
Nori Nikita
Salutations! My name's Nori Nikita. The cloud's my neighborhood. I don't like it when my bowl is empty, so I take it to my human and it magically refills! When I can break free, I enjoy exploring my neighborhood without my human. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 3%
  • Age 24 days
  • Racing Exp 25
  • Corgi 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 1 1 1
 Best Time15.37 sec
Rank 59  Racing *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCGTAAGCCCATACAGCTACTCCCGAACAGGA
C
C
C
G
T
A
A
G
C
C
C
A
T
A
C
A
G
C
T
A
C
T
C
C
C
G
A
A
C
A
G
G
A
Genes: LEO5JOJN94A

Composition

Corgi
18%
Border Collie
18%
Grey Wolf
9%
Shiba Inu
9%
Labrador
9%
Pitbull terrier
9%
French Bulldog
9%
Husky
9%
Dachshund
9%

Current Energy

Vitality +57 points
Lunar Effect +6 points

Traits Breakdown

Body Grey Wolf
Tail Shiba Inu
Legs Corgi
Front Legs Labrador
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Pitbull terrier
Nose French Bulldog
Eyes Husky
Color Dachshund