Carmela Connor Litecoin Game Dog - Mix of German Shepard, Labrador, Husky, Schnauzer, Pug, Golder Retriever, French Bulldog, Dachshund and Corgi

Achievements

Racer
Carmela Connor
Wassup? Yo, call me Carmela Connor. I like giving wet kisses. I've had my nose rubbed in 'it' more than once. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.
  • Purity 5%
  • Age 24 days
  • Racing Exp 33
  • German Shepard 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 3 0 1
 Best Time15.05 sec
Rank 24  Racing *** Pts
57.1 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCACCACCAACAATAGAAAGACGAGGATCAAGC
T
C
A
C
C
A
C
C
A
A
C
A
A
T
A
G
A
A
A
G
A
C
G
A
G
G
A
T
C
A
A
G
C
Genes: 7554C289A7O

Composition

German Shepard
18%
Labrador
18%
Husky
9%
Schnauzer
9%
Pug
9%
Golder Retriever
9%
French Bulldog
9%
Dachshund
9%
Corgi
9%

Current Energy

Vitality +39 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Labrador
Legs Labrador
Front Legs Husky
Head Schnauzer
Ears Pug
Snout Golder Retriever
Mouth French Bulldog
Nose Dachshund
Eyes German Shepard
Color Corgi