Barney Blondie Digital Cryptocurrency Dog - Mix of Husky, Corgi, Pug, Rottweiler, Golder Retriever and Boxer

Achievements

None
Barney Blondie
Hey there... I'm Barney Blondie. My favorite place in the world is the dog park. So many smells! I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'll eat my vomit and yours too. Let me have a pig's ear and I'm in heaven.
  • Purity 27%
  • Age 25 days
  • Racing Exp 0
  • Husky 55%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAAGCACAGAACACACAACAAGAAACACA
A
C
A
A
C
A
A
G
C
A
C
A
G
A
A
C
A
C
A
C
A
A
C
A
A
G
A
A
A
C
A
C
A
Genes: 44O42H448G4

Composition

Husky
55%
Corgi
9%
Pug
9%
Rottweiler
9%
Golder Retriever
9%
Boxer
9%

Current Energy

Vitality +35 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Corgi
Front Legs Husky
Head Pug
Ears Rottweiler
Snout Husky
Mouth Husky
Nose Golder Retriever
Eyes Boxer
Color Husky

Parents

No Children