Hawkeye Hose Litecoin Dog - Mix of Shiba Inu, Boxer, Dachshund, Beagle and Labrador BK

Achievements

None
Hawkeye Hose
How do you do? I'm Hawkeye Hose. I live in cyberspace where you can turn me on. I'd like to help you shed your coat, baby. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 20%
  • Age 25 days
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAAACGTAGTAAACAACGTAGTAGGAGCAGGA
C
T
A
A
A
C
G
T
A
G
T
A
A
A
C
A
A
C
G
T
A
G
T
A
G
G
A
G
C
A
G
G
A
Genes: DGEEGGEEA6A

Composition

Shiba Inu
36%
Boxer
27%
Dachshund
18%
Beagle
9%
Labrador BK
9%

Current Energy

Vitality +5 points
Lunar Effect -6 points

Traits Breakdown

Body Beagle
Tail Boxer
Legs Shiba Inu
Front Legs Shiba Inu
Head Boxer
Ears Boxer
Snout Shiba Inu
Mouth Shiba Inu
Nose Dachshund
Eyes Labrador BK
Color Dachshund

Parents

No Children