Brooke Brunhilda Cryptocurrency Game Dog - Mix of Dachshund, Rottweiler, Pitbull terrier, German Shepard, Corgi, Labrador BK, Husky, Poodle and French Bulldog

Achievements

None
Brooke Brunhilda
Let me introduce myself, I'm Brooke Brunhilda. I am a web of clouds kind of dog. I don't appreciate being around bores who bark too much. After introductory sniffing, I like some licking. My favorite place to sleep is under the covers between my humans.
  • Purity 3%
  • Age 24 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGATCCTCAAGCGGACACGCAACACACGACCGA
G
G
A
T
C
C
T
C
A
A
G
C
G
G
A
C
A
C
G
C
A
A
C
A
C
A
C
G
A
C
C
G
A
Genes: AN7OAH64HI9

Composition

Dachshund
18%
Rottweiler
18%
Pitbull terrier
9%
German Shepard
9%
Corgi
9%
Labrador BK
9%
Husky
9%
Poodle
9%
French Bulldog
9%

Current Energy

Vitality +28 points
Lunar Effect +2 points

Traits Breakdown

Body Dachshund
Tail Pitbull terrier
Legs German Shepard
Front Legs Corgi
Head Dachshund
Ears Rottweiler
Snout Labrador BK
Mouth Husky
Nose Rottweiler
Eyes Poodle
Color French Bulldog