Brooke Brunhilda Cryptocurrency Game Dog - Mix of Dachshund, Rottweiler, Pitbull terrier, German Shepard, Corgi, Labrador BK, Husky, Poodle and French Bulldog

Achievements

None
Brooke Brunhilda
Let me introduce myself, I'm Brooke Brunhilda. I am a web of clouds kind of dog. I don't appreciate being around bores who bark too much. After introductory sniffing, I like some licking. My favorite place to sleep is under the covers between my humans.
  • Purity 3%
  • Age 15 months
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGATCCTCAAGCGGACACGCAACACACGACCGA
G
G
A
T
C
C
T
C
A
A
G
C
G
G
A
C
A
C
G
C
A
A
C
A
C
A
C
G
A
C
C
G
A
Genes: AN7OAH64HI9

Composition

Dachshund
18%
Rottweiler
18%
Pitbull terrier
9%
German Shepard
9%
Corgi
9%
Labrador BK
9%
Husky
9%
Poodle
9%
French Bulldog
9%

Current Energy

Vitality -32 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Pitbull terrier
Legs German Shepard
Front Legs Corgi
Head Dachshund
Ears Rottweiler
Snout Labrador BK
Mouth Husky
Nose Rottweiler
Eyes Poodle
Color French Bulldog

Parents

No Children