Roscoe Regal Litecoin Game Dog - Mix of Golder Retriever, Corgi, Husky, Labrador BK, Shiba Inu, Pitbull terrier, Pug and Dachshund

Achievements

None
Roscoe Regal
I'm all about a hard drive because you can't do anything with a floppy disc. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I hate it when I am not the center of attention. I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 8%
  • Age 25 days
  • Racing Exp 0
  • Golder Retriever 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCAGAAGAACAGCAGTAAGATCCAGCGAAGGA
A
G
C
A
G
A
A
G
A
A
C
A
G
C
A
G
T
A
A
G
A
T
C
C
A
G
C
G
A
A
G
G
A
Genes: O8846E8NO2A

Composition

Golder Retriever
27%
Corgi
18%
Husky
9%
Labrador BK
9%
Shiba Inu
9%
Pitbull terrier
9%
Pug
9%
Dachshund
9%

Current Energy

Vitality +33 points
Lunar Effect -12 points

Traits Breakdown

Body Corgi
Tail Golder Retriever
Legs Golder Retriever
Front Legs Husky
Head Labrador BK
Ears Shiba Inu
Snout Golder Retriever
Mouth Pitbull terrier
Nose Corgi
Eyes Pug
Color Dachshund