Tex Tex Digital Cryptocurrency Game Dog - Mix of Corgi, Dachshund, Boxer, Poodle, St. Bernard, Border Collie, Grey Wolf, Yorkshire Terrier, Maltese and Golder Retriever

Achievements

None
Tex Tex
Who's a good dog? Hopefully you! Tex Tex here. You can access my database anytime with your WiFi. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them!
  • Purity 1%
  • Age 24 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAAACGACTGATACCCCAGCTTAACCAGCAGA
G
G
A
A
A
C
G
A
C
T
G
A
T
A
C
C
C
C
A
G
C
T
T
A
A
C
C
A
G
C
A
G
A
Genes: AGIBJLOFKO8

Composition

Corgi
18%
Dachshund
9%
Boxer
9%
Poodle
9%
St. Bernard
9%
Border Collie
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Maltese
9%
Golder Retriever
9%

Current Energy

Vitality +19 points
Lunar Effect -6 points

Traits Breakdown

Body Dachshund
Tail Boxer
Legs Poodle
Front Legs St. Bernard
Head Border Collie
Ears Grey Wolf
Snout Corgi
Mouth Yorkshire Terrier
Nose Maltese
Eyes Corgi
Color Golder Retriever

Parents

No Children