Felix Fletcher Bitcoin Dog - Mix of Pitbull terrier, Boxer, Dachshund, St. Bernard, Golder Retriever, Yorkshire Terrier, Maltese and French Bulldog

Achievements

None
Felix Fletcher
How goes it? I'm Felix Fletcher. My humans say I bark too much, but I have a lot to say! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 8%
  • Age 27 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACGGATGATCCAGATTAACCAACTCCTCCCGA
A
A
C
G
G
A
T
G
A
T
C
C
A
G
A
T
T
A
A
C
C
A
A
C
T
C
C
T
C
C
C
G
A
Genes: GABN8FKGNN9

Composition

Pitbull terrier
27%
Boxer
18%
Dachshund
9%
St. Bernard
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Maltese
9%
French Bulldog
9%

Current Energy

Vitality +4 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Dachshund
Legs St. Bernard
Front Legs Pitbull terrier
Head Golder Retriever
Ears Yorkshire Terrier
Snout Maltese
Mouth Boxer
Nose Pitbull terrier
Eyes Pitbull terrier
Color French Bulldog