Bell Blue Crypto Game Dog - Mix of Boxer, Labrador BK, German Shepard, Labrador, Schnauzer, Yorkshire Terrier, Maltese, Husky, Grey Wolf, Beagle and French Bulldog

Achievements

Podium Champion
Pro Racer
Bell Blue
I work in The Virtual Machine. I don't mind sharing my bed with someone I just met, if we can cuddle. My favorite treat is to steal the pepperoni off of pizza. I really dislike stinky flea collars. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. Just looking to sow some wild oats here...
  • Purity 0%
  • Age 25 days
  • Racing Exp 60
  • Mixed-breed
  • 10 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 4 2 2
 Best Time14.90 sec
Rank 16  Racing *** Pts
80.0 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACGCATCACCAATATTAACCACACCCCTACGA
A
A
C
G
C
A
T
C
A
C
C
A
A
T
A
T
T
A
A
C
C
A
C
A
C
C
C
C
T
A
C
G
A
Genes: G675CFK4LD9

Composition

Boxer
9%
Labrador BK
9%
German Shepard
9%
Labrador
9%
Schnauzer
9%
Yorkshire Terrier
9%
Maltese
9%
Husky
9%
Grey Wolf
9%
Beagle
9%
French Bulldog
9%

Current Energy

Vitality +35 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Labrador BK
Legs German Shepard
Front Legs Labrador
Head Schnauzer
Ears Yorkshire Terrier
Snout Maltese
Mouth Husky
Nose Grey Wolf
Eyes Beagle
Color French Bulldog