Missie Moses Bitcoin Dog - Mix of Dachshund, Boxer, French Bulldog, German Shepard, Corgi, Shiba Inu, Labrador and Golder Retriever

Achievements

None
Missie Moses
Whatcha know, honey. Missie Moses here. I'm having some new data architecture built for me, then I'd like to have you over to my place. I love unconditionally. I don't like running outta pee when there are still so many trees. I could spend days on end chasing my tail. I get so close but it's just so fast!
  • Purity 6%
  • Age 28 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 17
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGACGATCAGGAAACAGCGTAGGACCAAGAAAC
G
G
A
C
G
A
T
C
A
G
G
A
A
A
C
A
G
C
G
T
A
G
G
A
C
C
A
A
G
A
A
A
C
Genes: A97AGOEA58G

Composition

Dachshund
27%
Boxer
18%
French Bulldog
9%
German Shepard
9%
Corgi
9%
Shiba Inu
9%
Labrador
9%
Golder Retriever
9%

Current Energy

Vitality +26 points
Lunar Effect -16 points

Traits Breakdown

Body Dachshund
Tail French Bulldog
Legs German Shepard
Front Legs Dachshund
Head Boxer
Ears Corgi
Snout Shiba Inu
Mouth Dachshund
Nose Labrador
Eyes Golder Retriever
Color Boxer

Parents

No Children