Duke Damon Bitcoin Dog - Mix of Rottweiler, St. Bernard, Labrador BK, Corgi, German Shepard, Labrador, Border Collie, Beagle and Shiba Inu

Achievements

None
Duke Damon
When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I love a good book... I find them quite tasty. I've always wanted to be in commercials and be treated as the star I am! If you have fleas or ticks, don't bother.
  • Purity 5%
  • Age 28 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCACACAGCTCACCATGATGATACCTAGTACAC
G
C
A
C
A
C
A
G
C
T
C
A
C
C
A
T
G
A
T
G
A
T
A
C
C
T
A
G
T
A
C
A
C
Genes: 6HO75BBJDEH

Composition

Rottweiler
18%
St. Bernard
18%
Labrador BK
9%
Corgi
9%
German Shepard
9%
Labrador
9%
Border Collie
9%
Beagle
9%
Shiba Inu
9%

Current Energy

Vitality +45 points
Lunar Effect +6 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Corgi
Front Legs German Shepard
Head Labrador
Ears St. Bernard
Snout St. Bernard
Mouth Border Collie
Nose Beagle
Eyes Shiba Inu
Color Rottweiler

Parents

No Children