Jada Jimmuy Crypto Dog - Mix of Shiba Inu, St. Bernard, Maltese, Rottweiler, Pitbull terrier, Corgi and Grey Wolf

Achievements

Podium Champion
Pro Racer
Jada Jimmuy
What's up? I'm Jada Jimmuy. Power outages and computer viruses scare me! I like exploring off leash best. Removing excess stuffing from pillows is my favorite hobby. My 'G' spot is under my chin...scratch me there and I'll growl softly. I'm hoping to find someone who'll howl at the moon with me.
  • Purity 9%
  • Age 29 days
  • Racing Exp 59
  • Shiba Inu 27%
  • 12 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

12 races   |
  • 2 3 3
 Best Time15.65 sec
Rank 76  Racing *** Pts
66.7 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTACACTGAACCTCCGTAAGCTGAACCCCCGTA
G
T
A
C
A
C
T
G
A
A
C
C
T
C
C
G
T
A
A
G
C
T
G
A
A
C
C
C
C
C
G
T
A
Genes: EHBKNEOBKLE

Composition

Shiba Inu
27%
St. Bernard
18%
Maltese
18%
Rottweiler
9%
Pitbull terrier
9%
Corgi
9%
Grey Wolf
9%

Current Energy

Vitality 0 points
Lunar Effect +8 points

Traits Breakdown

Body Shiba Inu
Tail Rottweiler
Legs St. Bernard
Front Legs Maltese
Head Pitbull terrier
Ears Shiba Inu
Snout Corgi
Mouth St. Bernard
Nose Maltese
Eyes Grey Wolf
Color Shiba Inu