Toto Tobie Bitcoin Game Dog - Mix of German Shepard, Border Collie, Rottweiler, Husky, Pitbull terrier and Pug

Achievements

None
Toto Tobie
Someday I'm gonna breakout from inside this server. I hate it when my human runs out of poop-bags. How embarrassing! When my human brushes my coat, I get frisky! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 11%
  • Age 27 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACCACACATACTCCACATCATCAGAATCACAC
T
A
C
C
A
C
A
C
A
T
A
C
T
C
C
A
C
A
T
C
A
T
C
A
G
A
A
T
C
A
C
A
C
Genes: JH4JN47727H

Composition

German Shepard
27%
Border Collie
18%
Rottweiler
18%
Husky
18%
Pitbull terrier
9%
Pug
9%

Current Energy

Vitality +33 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Rottweiler
Legs Husky
Front Legs Border Collie
Head Pitbull terrier
Ears Husky
Snout German Shepard
Mouth German Shepard
Nose Pug
Eyes German Shepard
Color Rottweiler