Puppy Peanuts Crypto Dog - Mix of Beagle, Husky, Border Collie, Labrador, Golder Retriever, German Shepard, Grey Wolf and Shiba Inu

Achievements

Racer
Speed Champion
TOP 10 Fastest
Puppy Peanuts
Hey dawg! I'm Puppy Peanuts. I make the best virtual pet. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I hate it when my humans fool me with a pill in peanut butter! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 4%
  • Age 30 days
  • Racing Exp 19
  • Beagle 18%
  • 5 races
  • Gen 1
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

5 races   |
  • 2 0 0
 Best Time13.80 sec
Rank 1  Racing *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACTAACAAGATCACCCTACGTACTAACATAC
C
C
A
C
T
A
A
C
A
A
G
A
T
C
A
C
C
C
T
A
C
G
T
A
C
T
A
A
C
A
T
A
C
Genes: 5D487LJED4J

Composition

Beagle
18%
Husky
18%
Border Collie
18%
Labrador
9%
Golder Retriever
9%
German Shepard
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality +51 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Beagle
Legs Husky
Front Legs Golder Retriever
Head German Shepard
Ears Grey Wolf
Snout Border Collie
Mouth Shiba Inu
Nose Beagle
Eyes Husky
Color Border Collie

Parents

No Children

Photos

virtual doggy race podium Bitcoin pet racing podium