Lucy Laika Cryptocurrency Game Dog - Mix of German Shepard, Border Collie, Boxer, Corgi, Labrador BK, Labrador, French Bulldog and Husky

Achievements

None
Lucy Laika
I've always had a crush on Lassie. My favorite chews are underwear and rawhide...the rawhide lasts longer. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I enjoy mixing it up once in a while by visiting different dog parks.
  • Purity 6%
  • Age 29 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAAGCGCATACAACCCAAACCGAACATACTCA
T
C
A
A
G
C
G
C
A
T
A
C
A
A
C
C
C
A
A
A
C
C
G
A
A
C
A
T
A
C
T
C
A
Genes: 7O6JG5G94J7

Composition

German Shepard
18%
Border Collie
18%
Boxer
18%
Corgi
9%
Labrador BK
9%
Labrador
9%
French Bulldog
9%
Husky
9%

Current Energy

Vitality +53 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Labrador BK
Front Legs Border Collie
Head Boxer
Ears Labrador
Snout Boxer
Mouth French Bulldog
Nose Husky
Eyes Border Collie
Color German Shepard