Tiggy Tootsie Litecoin Game Dog - Mix of German Shepard, Pug, Corgi, Labrador, Golder Retriever and Boxer

Achievements

None
Tiggy Tootsie
It's a barkin' beautiful day! Tiggy Tootsie here. Taking a break from chasing Nyan Cat around cyberspace. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 9%
  • Age 28 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAGAATCAAGAAACAGCGAATCACCAAGCCCA
T
C
A
G
A
A
T
C
A
A
G
A
A
A
C
A
G
C
G
A
A
T
C
A
C
C
A
A
G
C
C
C
A
Genes: 7278GO275O5

Composition

German Shepard
27%
Pug
18%
Corgi
18%
Labrador
18%
Golder Retriever
9%
Boxer
9%

Current Energy

Vitality +43 points
Lunar Effect -12 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs German Shepard
Front Legs Golder Retriever
Head Boxer
Ears Corgi
Snout Pug
Mouth German Shepard
Nose Labrador
Eyes Corgi
Color Labrador

Parents

No Children