Ben Billy Bitcoin Game Dog - Mix of Shiba Inu, Labrador, Corgi, Yorkshire Terrier, Boxer, Dachshund and German Shepard

Achievements

None
Ben Billy
Oh, go ahead. Pet me. I know you want to. Chasing anything that will run is so much fun, I could do that all day. I hate going to the vet and will do almost anything to avoid it. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 9%
  • Age 15 months
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTATTAAACCCAAGCGGACCAGTATCAAGCGTA
G
T
A
T
T
A
A
A
C
C
C
A
A
G
C
G
G
A
C
C
A
G
T
A
T
C
A
A
G
C
G
T
A
Genes: EFG5OA5E7OE

Composition

Shiba Inu
27%
Labrador
18%
Corgi
18%
Yorkshire Terrier
9%
Boxer
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -33 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs Boxer
Front Legs Labrador
Head Corgi
Ears Dachshund
Snout Labrador
Mouth Shiba Inu
Nose German Shepard
Eyes Corgi
Color Shiba Inu

Parents

No Children