Twiggy Tuesday Crypto Dog - Mix of Border Collie, Boxer, Maltese, Yorkshire Terrier, German Shepard, Beagle and Grey Wolf

Achievements

None
Twiggy Tuesday
Hello, I'm Twiggy Tuesday. How's it goin'? I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I don't like running outta pee when there are still so many trees. I want someone who can show me a good time; I'll do the same for you.
  • Purity 11%
  • Age 28 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCTTATCATACCTAAACCCCAACTACTACAAC
A
C
C
T
T
A
T
C
A
T
A
C
C
T
A
A
A
C
C
C
C
A
A
C
T
A
C
T
A
C
A
A
C
Genes: KF7JDGLGJJG

Composition

Border Collie
27%
Boxer
27%
Maltese
9%
Yorkshire Terrier
9%
German Shepard
9%
Beagle
9%
Grey Wolf
9%

Current Energy

Vitality +32 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Yorkshire Terrier
Legs German Shepard
Front Legs Border Collie
Head Beagle
Ears Boxer
Snout Grey Wolf
Mouth Boxer
Nose Border Collie
Eyes Border Collie
Color Boxer