Twiggy Tuesday Crypto Dog - Mix of Border Collie, Boxer, Maltese, Yorkshire Terrier, German Shepard, Beagle and Grey Wolf

Achievements

Podium Champion
Pro Racer
Twiggy Tuesday
Hello, I'm Twiggy Tuesday. How's it goin'? I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I don't like running outta pee when there are still so many trees. I want someone who can show me a good time; I'll do the same for you.
  • Purity 11%
  • Age 5 months
  • Racing Exp 69
  • Border Collie 27%
  • 17 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 2 3 4
 Best Time15.38 sec
Rank 23  Racing *** Coins
52.9 % wins (9) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: ACCTTATCATACCTAAACCCCAACTACTACAAC
A
C
C
T
T
A
T
C
A
T
A
C
C
T
A
A
A
C
C
C
C
A
A
C
T
A
C
T
A
C
A
A
C
Genes: KF7JDGLGJJG

Composition

Border Collie
27%
Boxer
27%
Maltese
9%
Yorkshire Terrier
9%
German Shepard
9%
Beagle
9%
Grey Wolf
9%

Current Energy

Vitality -28 points
Lunar Effect -16 points

Traits Breakdown

Body Maltese
Tail Yorkshire Terrier
Legs German Shepard
Front Legs Border Collie
Head Beagle
Ears Boxer
Snout Grey Wolf
Mouth Boxer
Nose Border Collie
Eyes Border Collie
Color Boxer

Parents

No Children

Photos

crypto canine race crypto canine racing results online dog racing crypto doggy race results Litecoin dog racing online dog race Litecoin dog racing crypto canine racing