Ram Ryder Bitcoin Dog - Mix of Maltese, Labrador, Shiba Inu, Corgi, St. Bernard, French Bulldog and Schnauzer

Achievements

None
Ram Ryder
Size matters. This dawg's into big databases. Dragging my butt on the carpet feels so good. Chasing anything that will run is so much fun, I could do that all day. I don't like to be ignored. I like to play fetch with a tennis ball.
  • Purity 9%
  • Age 2 months
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCTGACGAATACCAGTACCAAGCAGCGTAACC
A
C
C
T
G
A
C
G
A
A
T
A
C
C
A
G
T
A
C
C
A
A
G
C
A
G
C
G
T
A
A
C
C
Genes: KB9C5E5OOEK

Composition

Maltese
18%
Labrador
18%
Shiba Inu
18%
Corgi
18%
St. Bernard
9%
French Bulldog
9%
Schnauzer
9%

Current Energy

Vitality -25 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail St. Bernard
Legs French Bulldog
Front Legs Schnauzer
Head Labrador
Ears Shiba Inu
Snout Labrador
Mouth Corgi
Nose Corgi
Eyes Shiba Inu
Color Maltese

Parents

No Children