K-9 Koba Crypto Dog - Mix of Husky, Border Collie, Yorkshire Terrier, Rottweiler, Pitbull terrier, Beagle and Boxer

Achievements

None
K-9 Koba
Top o' the mornin' to ya! I'm K-9 Koba. I've been known to take mega bytes when playing ruff. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. New experiences? New treats? New places! Yes, please!
  • Purity 9%
  • Age 28 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACACAACATACTCCTTACTATTATACAACACA
C
A
C
A
C
A
A
C
A
T
A
C
T
C
C
T
T
A
C
T
A
T
T
A
T
A
C
A
A
C
A
C
A
Genes: H44JNFDFJG4

Composition

Husky
27%
Border Collie
18%
Yorkshire Terrier
18%
Rottweiler
9%
Pitbull terrier
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality +37 points
Lunar Effect +8 points

Traits Breakdown

Body Rottweiler
Tail Husky
Legs Husky
Front Legs Border Collie
Head Pitbull terrier
Ears Yorkshire Terrier
Snout Beagle
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Boxer
Color Husky