Jess Jester Crypto Dog - Mix of Beagle, Rottweiler, Schnauzer, Pitbull terrier, St. Bernard, Labrador, Dachshund, Boxer and Labrador BK

Achievements

None
Jess Jester
You'll find me walking into my favorite pet store like I own the place. I do, don't I? My humans should try spending 8 hours a day in a crate! When my human brushes my coat, I get frisky! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized.
  • Purity 3%
  • Age 30 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATACTATCCCACTGACTACCAGGAAACGCACAC
A
T
A
C
T
A
T
C
C
C
A
C
T
G
A
C
T
A
C
C
A
G
G
A
A
A
C
G
C
A
C
A
C
Genes: CDNHBD5AG6H

Composition

Beagle
18%
Rottweiler
18%
Schnauzer
9%
Pitbull terrier
9%
St. Bernard
9%
Labrador
9%
Dachshund
9%
Boxer
9%
Labrador BK
9%

Current Energy

Vitality +15 points
Lunar Effect +4 points

Traits Breakdown

Body Schnauzer
Tail Beagle
Legs Pitbull terrier
Front Legs Rottweiler
Head St. Bernard
Ears Beagle
Snout Labrador
Mouth Dachshund
Nose Boxer
Eyes Labrador BK
Color Rottweiler