Banjo Hitter Bradley Bitcoin Game Dog - Mix of German Shepard, Yorkshire Terrier, Pitbull terrier, Grey Wolf, St. Bernard, Labrador BK and Husky

Achievements

None
Banjo Hitter Bradley
A-yo...Call me Banjo Hitter Bradley. My favorite way to relax is to be scratched on my belly. I love the smell of freshly cut grass. Fences are just challenges...I don't let them stop me! If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 11%
  • Age 28 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCTGAGCATCATCATTATTATCATCCACATCC
C
C
C
T
G
A
G
C
A
T
C
A
T
C
A
T
T
A
T
T
A
T
C
A
T
C
C
A
C
A
T
C
C
Genes: LB677FF7N4N

Composition

German Shepard
27%
Yorkshire Terrier
18%
Pitbull terrier
18%
Grey Wolf
9%
St. Bernard
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality +67 points
Lunar Effect +10 points

Traits Breakdown

Body Grey Wolf
Tail St. Bernard
Legs Labrador BK
Front Legs German Shepard
Head German Shepard
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth German Shepard
Nose Pitbull terrier
Eyes Husky
Color Pitbull terrier

Parents

No Children