Halfback Hope Crypto Dog - Mix of Dachshund, Pitbull terrier, Grey Wolf, Boxer, Rottweiler, Beagle, Poodle, Pug, Border Collie, German Shepard and Maltese

Achievements

None
Halfback Hope
Howdy! I'm Halfback Hope. Someday I'm gonna breakout from inside this server. It doesn't matter to me which team I play for... I just like tail. I hate being left alone all day. Once I caught a seagull, but it scared me so I let it go. You scratch my belly and I'll scratch yours ;)
  • Purity 0%
  • Age 31 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGATCCCCCAACCACCTAGACGAATACTCAACC
G
G
A
T
C
C
C
C
C
A
A
C
C
A
C
C
T
A
G
A
C
G
A
A
T
A
C
T
C
A
A
C
C
Genes: ANLGHDI2J7K

Composition

Dachshund
9%
Pitbull terrier
9%
Grey Wolf
9%
Boxer
9%
Rottweiler
9%
Beagle
9%
Poodle
9%
Pug
9%
Border Collie
9%
German Shepard
9%
Maltese
9%

Current Energy

Vitality +26 points
Lunar Effect -8 points

Traits Breakdown

Body Dachshund
Tail Pitbull terrier
Legs Grey Wolf
Front Legs Boxer
Head Rottweiler
Ears Beagle
Snout Poodle
Mouth Pug
Nose Border Collie
Eyes German Shepard
Color Maltese

Parents

No Children