Sweet Tooth Squeakers Cryptocurrency Game Dog - Mix of Pitbull terrier, Labrador BK, Rottweiler, Dachshund, St. Bernard, Golder Retriever, Schnauzer and Boxer

Achievements

Podium Champion
Pro Racer
Sweet Tooth Squeakers
Howdy there. I'm Sweet Tooth Squeakers. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I'm a serial monogamist. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Slipping my collar, running off and making my humans worried? Every chance I get.
  • Purity 8%
  • Age 30 days
  • Racing Exp 51
  • Pitbull terrier 27%
  • 13 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

13 races   |
  • 3 2 1
 Best Time15.47 sec
Rank 91  Racing *** Pts
46.2 % wins (6) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CACGGATGATCCAGAATAGCAAACTCCTCCGCA
C
A
C
G
G
A
T
G
A
T
C
C
A
G
A
A
T
A
G
C
A
A
A
C
T
C
C
T
C
C
G
C
A
Genes: HABN8C6GNN6

Composition

Pitbull terrier
27%
Labrador BK
18%
Rottweiler
9%
Dachshund
9%
St. Bernard
9%
Golder Retriever
9%
Schnauzer
9%
Boxer
9%

Current Energy

Vitality +9 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Dachshund
Legs St. Bernard
Front Legs Pitbull terrier
Head Golder Retriever
Ears Schnauzer
Snout Labrador BK
Mouth Boxer
Nose Pitbull terrier
Eyes Pitbull terrier
Color Labrador BK