Skippy Scottie Crypto Dog - Mix of Shiba Inu, Golder Retriever, St. Bernard, Maltese, Pitbull terrier, Corgi, Dachshund, German Shepard and Husky

Achievements

Pro Racer
Skippy Scottie
If you'd like to get together, I'm Skippy Scottie. I like to respond to sad puppy eyes with sad puppy eyes of my own. You know the worst? Watching my humans 'get it on' when I've got no one. I never met a crotch or a butt I didn't like, but I'm just friendly that way.
  • Purity 6%
  • Age 15 months
  • Racing Exp 50
  • Shiba Inu 27%
  • 10 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 4 2 0
 Best Time15.07 sec
No rank  Racing *** Coins
60.0 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAAGATGAACCTCCGTAAGCGGATCAACAGTA
G
T
A
A
G
A
T
G
A
A
C
C
T
C
C
G
T
A
A
G
C
G
G
A
T
C
A
A
C
A
G
T
A
Genes: E8BKNEOA74E

Composition

Shiba Inu
27%
Golder Retriever
9%
St. Bernard
9%
Maltese
9%
Pitbull terrier
9%
Corgi
9%
Dachshund
9%
German Shepard
9%
Husky
9%

Current Energy

Vitality -50 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs St. Bernard
Front Legs Maltese
Head Pitbull terrier
Ears Shiba Inu
Snout Corgi
Mouth Dachshund
Nose German Shepard
Eyes Husky
Color Shiba Inu

Parents

Children

Photos

virtual dog race Bitcoin canine race photo crypto dog racing Litecoin dog racing photo crypto dog race podium crypto doggy racing podium