Skippy Scottie Crypto Dog - Mix of Shiba Inu, Golder Retriever, St. Bernard, Maltese, Pitbull terrier, Corgi, Dachshund, German Shepard and Husky

Achievements

Racer
Skippy Scottie
If you'd like to get together, I'm Skippy Scottie. I like to respond to sad puppy eyes with sad puppy eyes of my own. You know the worst? Watching my humans 'get it on' when I've got no one. I never met a crotch or a butt I didn't like, but I'm just friendly that way.
  • Purity 6%
  • Age 29 days
  • Racing Exp 48
  • Shiba Inu 27%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 4 2 0
 Best Time15.07 sec
Rank 78  Racing *** Pts
75.0 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAAGATGAACCTCCGTAAGCGGATCAACAGTA
G
T
A
A
G
A
T
G
A
A
C
C
T
C
C
G
T
A
A
G
C
G
G
A
T
C
A
A
C
A
G
T
A
Genes: E8BKNEOA74E

Composition

Shiba Inu
27%
Golder Retriever
9%
St. Bernard
9%
Maltese
9%
Pitbull terrier
9%
Corgi
9%
Dachshund
9%
German Shepard
9%
Husky
9%

Current Energy

Vitality +10 points
Lunar Effect +8 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs St. Bernard
Front Legs Maltese
Head Pitbull terrier
Ears Shiba Inu
Snout Corgi
Mouth Dachshund
Nose German Shepard
Eyes Husky
Color Shiba Inu

Parents

Children

Photos

cryptocurrency doggy racing Litecoin dog racing cryptocurrency pet racing podium Litecoin doggy racing online dog race virtual doggy race photo