Everet Earl Bitcoin Game Dog - Mix of German Shepard, Maltese, St. Bernard, Grey Wolf, Schnauzer, Labrador BK, Yorkshire Terrier, Labrador, Corgi and Golder Retriever

Achievements

Racer
Podium Champion
Everet Earl
I make the best virtual pet. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! When I hook up, I stay hooked up for about 20 minutes. I'm sick of having my nails clipped, those are to help me dig! I am on a mission to sniff all the butts in the world. ALL the butts.
  • Purity 3%
  • Age 29 days
  • Racing Exp 44
  • German Shepard 18%
  • 9 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 2 1 3
 Best Time15.32 sec
No rank  Racing *** Pts
66.7 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATCAACCTGACCCATAGCATTACCAAGCAGA
T
C
A
T
C
A
A
C
C
T
G
A
C
C
C
A
T
A
G
C
A
T
T
A
C
C
A
A
G
C
A
G
A
Genes: 77KBLC6F5O8

Composition

German Shepard
18%
Maltese
9%
St. Bernard
9%
Grey Wolf
9%
Schnauzer
9%
Labrador BK
9%
Yorkshire Terrier
9%
Labrador
9%
Corgi
9%
Golder Retriever
9%

Current Energy

Vitality +17 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Maltese
Front Legs St. Bernard
Head Grey Wolf
Ears Schnauzer
Snout Labrador BK
Mouth Yorkshire Terrier
Nose Labrador
Eyes Corgi
Color Golder Retriever

Parents

Children

Photos

virtual canine race podium cryptocurrency pet race photo crypto dog race Litecoin dog race crypto pet racing results cryptocurrency canine racing