Hobbes Hobbit Crypto Dog - Mix of Maltese, Golder Retriever, Rottweiler, Border Collie, Dachshund, Schnauzer, St. Bernard, Grey Wolf and Shiba Inu

Achievements

Podium Champion
Pro Racer
Hobbes Hobbit
Hi! I'm Hobbes Hobbit! I live in your digital dreams. You know the worst? Watching my humans 'get it on' when I've got no one. I adore sleeping upside down with my tongue hanging out! I absolutely love long walks when I can stop and smell the bushes. If we can run as a pack for a while, I'm open to that.
  • Purity 3%
  • Age 29 days
  • Racing Exp 49
  • Maltese 18%
  • 11 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

11 races   |
  • 3 2 1
 Best Time14.85 sec
Rank 39  Racing *** Pts
54.5 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCCACTACAGAGGAATAAGATGAACCCCCGTA
A
C
C
C
A
C
T
A
C
A
G
A
G
G
A
A
T
A
A
G
A
T
G
A
A
C
C
C
C
C
G
T
A
Genes: KHJ8AC8BKLE

Composition

Maltese
18%
Golder Retriever
18%
Rottweiler
9%
Border Collie
9%
Dachshund
9%
Schnauzer
9%
St. Bernard
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality +18 points
Lunar Effect +12 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs Border Collie
Front Legs Golder Retriever
Head Dachshund
Ears Schnauzer
Snout Golder Retriever
Mouth St. Bernard
Nose Maltese
Eyes Grey Wolf
Color Shiba Inu

Parents

Children

Photos

virtual dog racing results Litecoin canine racing podium online dog racing online dog racing online doggy racing virtual doggy race photo