Mickey Morgan Bitcoin Dog - Mix of Corgi, Boxer, Shiba Inu, Border Collie, St. Bernard, Labrador, Pug, Schnauzer and Yorkshire Terrier

Achievements

Racer
Mickey Morgan
I'd like to help you shed your coat, baby. I'll be honest...Napping is my favorite so we gotta go slow. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I'm going kill that damn Nyan Cat if I can catch it.
  • Purity 5%
  • Age 29 days
  • Racing Exp 34
  • Corgi 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 3 0 1
 Best Time14.80 sec
No rank  Racing *** Pts
50.0 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCAGCGTATACTGACCAGAAAACATAAACTTA
A
G
C
A
G
C
G
T
A
T
A
C
T
G
A
C
C
A
G
A
A
A
A
C
A
T
A
A
A
C
T
T
A
Genes: OOEJB52GCGF

Composition

Corgi
18%
Boxer
18%
Shiba Inu
9%
Border Collie
9%
St. Bernard
9%
Labrador
9%
Pug
9%
Schnauzer
9%
Yorkshire Terrier
9%

Current Energy

Vitality +27 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs Shiba Inu
Front Legs Border Collie
Head St. Bernard
Ears Labrador
Snout Pug
Mouth Boxer
Nose Schnauzer
Eyes Boxer
Color Yorkshire Terrier

Parents

Children

Photos

online canine race Litecoin pet race results virtual canine racing Litecoin dog racing